Archive for the ‘Currents/Weekly Wide Web’ Category
How Does Your Garden Grow?
by Nick Smith
Ever wish there were some way to get inexpensive, fresh food without leaving your neighborhood? Now through the miracle of gardening (note: not an actual miracle), you can make that wish come true, right in your own backyard. Don’t have room? Then you can reserve a plot with the Community Gardens of Tucson for a scant $15 a month. Growing your own vegetables seems like a surefire way to finally break the tyranny of the local supermarket’s produce department, but…
[ Subscribe to the comments on this story ]
Post Footer automatically generated by Add Post Footer Plugin for wordpress.
U of A DNA
by Nick Smith
Ever wonder where you came from? If your mom isn’t around to give you the answer, we’ve got it right here. The folks at the UA’s Human Origins Genotyping Laboratory are in the process of mapping where in the world we all came from. The short answer comes in the form of a genetic family tree of hundreds of thousands of people already in the lab’s database. The long answer is ACAAGATGCCATTGTCCCCCGGC … (You get the idea.) You can see…
[ Subscribe to the comments on this story ]
Post Footer automatically generated by Add Post Footer Plugin for wordpress.
Spoon Van Gogh
by Nick Smith
Most of us can’t paint very well—let alone paint very well using eating utensils. Dale Strong does both. For her column this week, Irene Messina spoke with the artist and watched him paint a landscape from start to finish using spoons. Strong has them flattened and shapes the iced-tea spoons himself. He once stuck a spoon on a train track to get the perfect shape. In addition to teaching students how to paint and winning worldwide artistic accolades, Strong has…
[ Subscribe to the comments on this story ]
Post Footer automatically generated by Add Post Footer Plugin for wordpress.
Football and Vibrators
by Nick Smith
Now that I have your attention, here’s what’s new on the Web. We here at the Weekly Wide Web don’t often deal in “final scores” or “facts,” so we were happy to shut off the UA-Oregon football game while the Wildcats were ahead in the fourth quarter. Needless to say, the double-overtime loss was frustrating and unbelievable. While a case could be made that Wildcats kicker Alex Zendejas’ botched 24-yard field-goal attempt ultimately ruined the game for Arizona, I place…
[ Subscribe to the comments on this story ]
Post Footer automatically generated by Add Post Footer Plugin for wordpress.
The Same, but … OK, They’re Not the Same at All
by Nick Smith
The subjects of our two video picks this week couldn’t be more different. Our first video is about harvesting mesquite pods, and how to turn them into something edible. It’s next to impossible to live in Tucson and not drive over, kick or accidentally ingest the thin yellow pods that seem to decorate the ground year-round. If you have a sidewalk and a mesquite tree, chances are, you also have a really good broom. These crunchy little things have been…
[ Subscribe to the comments on this story ]
Post Footer automatically generated by Add Post Footer Plugin for wordpress.
Night of the (Mostly) Living Dead
by Nick Smith
If you were one of the thousands of people on Fourth Avenue and/or downtown last Sunday, Nov. 8, for the 20th Annual All Souls Procession, you probably saw dozens of people with fancy (read: expensive) camera equipment, steady-cam rigs, boom microphones and crane lifts. The people sporting this serious-looking stuff (and the unserious-looking orange armbands) were filming the event and the subsequent Calexico concert at the Rialto Theatre for the upcoming documentary Flor de Muertos. If you missed the procession…
[ Subscribe to the comments on this story ]
Post Footer automatically generated by Add Post Footer Plugin for wordpress.
